Translate this page into:
Phenotypic and molecular detection of Salmonella species with antimicrobial susceptibility patterns in clinical isolates
*Corresponding author: Saurabh Gupta, Department of Biotechnology, GLA University, Mathura, Uttar Pradesh, India. saurabh.gupta@gla.ac.in
-
Received: ,
Accepted: ,
How to cite this article: Deb J, Gupta S, Debnath S, Majumdar T. Phenotypic and molecular detection of Salmonella species with antimicrobial susceptibility patterns in clinical isolates. Sri Ramachandra J Health Sci. doi: 10.25259/SRJHS_21_2026
Abstract
Objectives:
Salmonella species are significant pathogens that cause a variety of clinical diseases. As antibiotic resistance increases, they are becoming a greater concern.
Material and Methods:
Conventional culture and biochemical techniques were used to isolate and identify 200 clinical samples for Salmonella species, and polymerase chain reaction (PCR) targeting a 796 bp gene fragment was used for molecular confirmation. The Kirby–Bauer disc diffusion technique was used to test for antimicrobial susceptibility.
Results:
Out of 200 samples, 7 (3%) included bacterial growth classified as Salmonella species. The isolates had normal cultural and biochemical characteristics, such as non-lactose fermenting colonies on MacConkey agar and black-centred colonies on xylose lysine deoxycholate and SalmonellaShigella agar. Salmonella was validated using PCR amplification, yielding, for molecular confirmation, the invA gene (796 bp fragment) as the target of PCR. Antibiotic susceptibility tests demonstrated perfect sensitivity to imipenem (100%), moderate sensitivity to ciprofloxacin (80%) and trimethoprim– sulfamethoxazole (60%), and high resistance to chloramphenicol (80%), azithromycin (80%), and ampicillin (60%).
Conclusion:
The investigation confirms the presence of multidrug-resistant Salmonella species in clinical samples. The significant resistance to conventional antibiotics emphasizes the importance of frequent antimicrobial monitoring, cautious antibiotic usage, and molecular confirmation in the identification and treatment of Salmonella infections.
Keywords
Antibiotic susceptibility
Clinical isolates
Multidrug resistance Salmonella
Polymerase chain reaction
Salmonella isolation
INTRODUCTION
Salmonella is a major worldwide pathogen that causes foodborne diseases, gastroenteritis, septicemia, and invasive infections in people and animals.[1] Contaminated meat, dairy products, and fresh vegetables act as reservoirs for Salmonella transmission, providing a significant public health risk.[2] Salmonella isolation and identification are critical for disease monitoring and outbreak investigation, and many culture medium have been standardized to do this.[3] Conventional culture techniques remain effective; however, quick molecular detection approaches are increasingly being employed for emergency response and food safety.[4] Antimicrobial resistance has emerged in Salmonella strains recovered from poultry and other food sources, complicating treatment efforts.[5] Salmonella infection in chicken is well recognized as a major source of illness, affecting both animal health and zoonotic transmission.[6] Egyptian studies have found Salmonella enterica, Escherichia coli O157:H7, and Shigella spp. in food items, underlining the potential of several enteric infections circulating concurrently.[7] Molecular tests have also shown the presence of S. enterica serovar Enteritidis in clinical and poultry house samples.[8] Invasive salmonellosis is still a significant clinical concern, with unique epidemiological, diagnostic, and antibiotic resistance difficulties globally.[9] Clinical and environmental Salmonella isolates from Saudi Arabia showed a variety of serotypes and resistance mechanisms.[10]
Genotypic and phenotypic variety among Salmonella isolates has been extensively reported in areas such as Kenya, where Salmonella typhimurium strains vary significantly.[11] In Egypt, locally isolated strains were described for antigen preparation, revealing both phenotypic and genotypic variation.[12] Similar studies in Turkey have indicated antibiotic resistance patterns in chicken isolates,[13] whereas research in Korea has shown diversity in Salmonella strains isolated from pigs and farm settings.[14] Brazilian studies revealed phenotypic and genotypic diversity in Salmonella Typhimurium strains isolated from patients and food items.[15] Ethiopian research found temporal links between nontyphoidal Salmonella strains in people and food animals, indicating a zoonotic cycle.[16] Research on imported chicken has also revealed resistance to S. enterica serovars.[17]
Bangladeshi research has discovered Salmonella in broilers and performed antibiogram tests, revealing local resistance trends.[18] Foodborne Salmonella infection has been widely documented from a variety of sources, demonstrating its widespread prevalence.[19] Furthermore, in Nepal, isolates from enteric fever patients showed varied susceptibility to conventional antibiotics, highlighting treatment problems.[20] Regional investigations are critical given Salmonella’s expanding clinical and epidemiological relevance, as well as the rise of antibiotic resistance. Tripura, located in Northeast India, has minimal information on the phenotypic and genotypic characteristics of Salmonella isolates.
Objectives
The present study aims to isolate and identify Salmonella species from clinical samples collected at a tertiary care hospital in Tripura. Furthermore, it seeks to characterize these isolates both phenotypically and genotypically, and to provide baseline data that may assist in clinical management, surveillance, and future research on antimicrobial resistance trends.
MATERIAL AND METHODS
Study type
This was a cross-sectional study.
Study duration
The duration of the study was January–December 2023
Study location
Regardless of age or gender, those who attended Agartala Government Medical College and Govind Ballabh Pant Hospital’s various outpatient departments.
Ethical
Before specimen collection, all subjects gave their consent, and the study was authorized by the Institutional Human Ethics Committee (Ethical approval number 4311/2022).
Inclusion and exclusion criteria of study participants
This study included individuals who had a fever for at least 1 week but had not begun antibiotic treatment, whereas those who had begun antibiotic medication were excluded.[2,9]
Sample collection
Venous blood samples (5 mL for adult and 1 mL for infants and pediatrics) were collected in brain heart infusion broth from all participants. A comprehensive questionnaire was filled by each patient, which asked about their age, gender, and any medications they were currently taking. Blood samples were collected from 200 consecutive febrile patients.[10,12]
Sample processing and culture methods
All samples were promptly transferred to the microbiology laboratory and processed aseptically. Salmonella was isolated using selective and differential media, including MacConkey agar, xylose lysine deoxycholate (XLD) agar, and Salmonella– Shigella (SS) agar. Before cultivation, samples were inoculated with selenite F broth to enrich them. Colony morphology was recorded, and suspicious colonies were submitted to further biochemical testing.[2,3]
Biochemical characterization
Isolates were identified using conventional biochemical assays such as triple sugar iron (TSI) agar, urease, citrate utilization, indole, methyl red, Voges–Proskauer, lysine decarboxylase, and motility tests.[4]
Antimicrobial susceptibility testing
Antimicrobial susceptibility was determined using the Kirby–Bauer disk diffusion technique on Mueller–Hinton agar (MHA) in accordance with Clinical and Laboratory Standards Institute (CLSI) standards. Prior to inoculation, bacterial suspensions were adjusted to a 0.5 McFarland turbidity standard to guarantee consistent inoculum density before completing Kirby–Bauer disk diffusion tests on MHA. Ampicillin, ciprofloxacin, cotrimoxazole, ceftriaxone, cefixime, chloramphenicol, azithromycin, and imipenem were among the medicines studied to treat Salmonella. The results were evaluated as Susceptible (S), Intermediate (I), and Resistant (R) according to the CLSI guidelines.[5,6]
Genotypic characterization
DNA was extracted from the isolates using the boiling technique. The invA gene, a standard marker for Salmonella confirmation, was amplified via PCR (Ahmed and Shimamoto, 2014). Amplified products were observed on agarose gel electrophoresis and evaluated against molecular weight markers.[7] The invA gene was chosen as the molecular target because it is a highly conserved virulence gene unique to Salmonella species and is widely accepted as a standard marker for rapid and reliable genus-level confirmation.
Polymerase chain reaction (PCR)
In order to identify Salmonella at the genus level, a 25 μL PCR mixture was prepared with 2.5 μL 10 × PCR buffer, 2.5 μL 25 mM MgCl 2, 2 μL dNTP Set, 0.25 μL 5 U/μL Taq DNA Polymerase enzyme, 1 μL of each genus-specific primer pair (20 pmol) Table 1, 1 μL of target DNA, and 14.75 μL of DNase-RNase-free water Table 1.[21] To validate amplification specificity and eliminate contamination, PCR amplification was performed with a previously confirmed Salmonella isolate as a positive control and DNase/RNase-free water as a negative control.
| Agent | Gene | Primer sequences | Fragment size (bp) | Length | GC% | Tm |
|---|---|---|---|---|---|---|
| Salmonella spp. | invA | F-3’CGGTGGTTTTAAGCGTACTCTT 5’ | 796 | 22 | 45.45 | 58.94 |
| R-5’ CGAATATGCTCCACAAGGTTA 3’ | 21 | 42.86 | 55.77 |
RESULTS
In this study 200 clinical samples were included. Out of this total samples 7 cases (3%), bacterial growth was obtained, and 193 cases (97%), no growth was recorded. The study’s participants were 61% (n - 123) men and 39% (n - 77) women.
Colony morphology and biochemical characteristic of
Salmonella species
Salmonella isolates from positive culture plates showed distinctive colony shape on selective and differential media. On MacConkey agar, colonies were pale, nonlactose fermenting, smooth, and transparent. On XLD agar, colonies were red with black cores owing to hydrogen sulfide (H2S) generation, but on SS agar, colonies were colorless with noticeable black centers. Biochemical analysis showed that the isolates developed an alkaline slant and acid butt with H2S production on TSI agar, indicating glucose fermentation and H2S generation. The isolates were all motile, citrate positive, and methyl red positive, but the indole, Voges-Proskauer, and urease assays were negative. These findings aligned with the normal biochemical profile of Salmonella species.
Antibiotic susceptibility pattern
Based on the antibiotic susceptibility patterns of the isolates, Imipenem had the maximum sensitivity 100%, suggesting that it was the most efficient medicine against the studied pathogens. Ciprofloxacin 80% and trimethoprim sulfamethoxazole 60% both showed promising activity. Ceftriaxone and cefixime showed moderate sensitivity 60% and 40%, respectively. In contrast, chloramphenicol 80% and azithromycin 80% showed the highest levels of resistance, followed by ampicillin 60%. Overall, the isolates exhibited multidrug resistance (MDR) to numerous routinely used antibiotics, with Imipenem remaining the most effective antimicrobial agent.
Molecular analysis
The amplified PCR products were electrophoresed on a 1.5% agarose gel with 10 μL of ethidium bromide solution, inspected under an ultraviolet transilluminator, and photographed. A 1 kb plus DNA ladder was used to calculate the molecular weight of the obtained bands. Following agarose gel electrophoresis, PCR products with molecular sizes of around 796 bp and DNase-RNase-free water were employed as negative controls in both the DNA extraction and PCR analysis [Figure 1].

DISCUSSION
In the current investigation, 200 clinical samples were evaluated, with 7 (3%) demonstrating bacterial growth and 193 (97%) revealing no growth. This study’s Salmonella species isolation rate was lower than that of Nair et al.,[1] who found a higher prevalence in diarrheagenic samples from infants and young animals who found a significant frequency of Salmonella and E. coli contamination in raw meat. Differences in isolation rate can be attributable to sample type, geographic circumstances, hygiene procedures, and infection control strategies.
The Salmonella isolates in this study showed characteristic morphological features on selective media, pale, non-lactose fermenting colonies on MacConkey agar; red colonies with black centers on XLD agar; and colorless colonies with black centers on SS agar, findings consistent with those of Neyaz et al. and Lee et al.,[3,4] who emphasized these classical colony morphologies as reliable indicators of Salmonella isolation. Biochemically, the isolates were motile, citrate positive, methyl red positive, and generated hydrogen sulfide on TSI agar, which is consistent with normal Salmonella biochemical profiles described by Ahmed and Shimamoto and Ibrahim et al.[7,12]
Antibiotic susceptibility tests indicated a worrying trend of MDR among the isolates. Imipenem had the maximum sensitivity 100%, followed by ciprofloxacin 80% and trimethoprim–sulfamethoxazole 60%, with intermediate sensitivity for ceftriaxone 60% and cefixime 40%. Chloramphenicol and azithromycin showed the highest levels of resistance 80% and 80%, respectively, followed by ampicillin 60%. These findings are consistent with previous publications by Castro-Vargas et al. and Maharjan et al.,[5,20] who found widespread antimicrobial resistance among Salmonella isolates, notably to routinely used first-line medicines such as ampicillin and chloramphenicol. El-Tayeb et al. and Ince and Akan have also documented similar resistance patterns, highlighting the global spread of MDR Salmonella strains.[10,13] According to publications by Eguale et al. and Arkali and Çetinkaya, the high susceptibility to imipenem seen here supports the idea that carbapenems are still a viable treatment choice for Salmonella species that are resistant to them.[16,21] To stop the emergence of resistance, their application should be limited to serious illnesses.
The identity of Salmonella isolates was further confirmed by molecular validation using PCR targeting the invA gene, as all culture-positive samples generated the anticipated 796 bp amplification band. The invA gene is a commonly used genetic marker for genus-level identification because it encodes invasion-associated proteins and is highly conserved among Salmonella serovars. Mezal et al. (2014) and Seribelli et al., (2020) who used gene-targeted amplification to confirm S. enterica serovars,[8,15] have described similar PCR-based molecular identification techniques. The successful amplification of the anticipated fragment in every isolate demonstrates the dependability and diagnostic value of PCR, especially in circumstances where culture-based techniques can be laborious, ambiguous, or linked to low bacterial load. Therefore, integrating molecular confirmation with conventional phenotypic methods enhances the accuracy of diagnosis and facilitates prompt and efficient infection control.
Overall, the current work highlights the ongoing clinical and public health relevance of Salmonella infections by showing that isolates of the bacteria show MDR to a number of widely used medicines. The comparatively low isolation rate and the observed resistance patterns, especially against conventional antimicrobial agents, highlight the significance of ongoing surveillance, prudent antibiotic use, and molecular confirmation techniques for precise diagnosis and efficient infection control. In line with local and international publications, our results provide more evidence that Salmonella is a significant nosocomial and zoonotic pathogen. However, the study’s single-center methodology and rather small sample size may limit how far the results can be applied. In order to offer more thorough knowledge of the epidemiology and antibiotic resistance patterns of Salmonella infections, additional multicentric research encompassing bigger populations and incorporating specific demographic and clinical characteristics is advised (Gast and Porter, 2020; Crump et al., 2015).[6,9]
CONCLUSION
Using distinctive cultural, biochemical, and molecular characteristics, this investigation validates the existence of Salmonella species in clinical samples. While imipenem continued to be very successful, the isolates showed substantial resistance to ampicillin, chloramphenicol, and azithromycin, indicating MDR. The results demonstrate the concerning increase in Salmonella’s resistance to antibiotics and emphasize the need for ongoing monitoring, prudent antibiotic usage, and molecular confirmation for precise diagnosis and efficient infection management.
Acknowledgment:
The Department of Microbiology and laboratory personnel at Agartala Government Medical College provided the facilities and technical support required for the study, for which the authors would like to thank for their support. We would want to express our profound appreciation to all of the caregivers and clinicians who helped with patient coordination and sample collection. We would like to express our gratitude to everyone who helped with data analysis and laboratory operations, but was not listed as a co-author on this publication.
Authors’ contributions:
JD: Laboratory analysis, validation, formal analysis, and writing, including the creation, review, and editing of the first draft; SG: Conceptualization, methodology, software, formal analysis, writing review & editing; SD: Data curation, writing review & editing, visualization, supervision; TM: Visualization, supervision, project administration, writing review & editing.
Ethical approval:
The research/study was approved by the Institutional Review Board at Agartala Government Medical College, number 4311/2022, dated 13th March 2024.
Declaration of patient consent:
The authors certify that they have obtained all appropriate patient consent forms. In the form, the patient has given consent for clinical information to be reported in the journal. The patient understands that the patient’s names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Conflicts of interest:
There are no conflicts of interest.
Use of artificial intelligence (AI)-assisted technology for manuscript preparation:
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript, and no images were manipulated using AI.
Financial support and sponsorship: Nil.
References
- Isolation and identification of Salmonella from diarrheagenic infants and young animals, sewage waste and fresh vegetables. Vet World. 2015;8:669-73.
- [CrossRef] [PubMed] [Google Scholar]
- Isolation and identification of Salmonella and Escherichia coli from raw goat meat in Uyo metropolis, Akwaibom State. Asian Food Sci J. 2020;14:50-60.
- [CrossRef] [Google Scholar]
- A comprehensive review on the current status of culture media for routine standardized isolation of Salmonella and Shigella spp. From contaminated food. J Umm Al-Qura Univ Appl Sci. 2024;29:1-4.
- [CrossRef] [Google Scholar]
- Review of Salmonella detection and identification methods: Aspects of rapid emergency response and food safety. Food Control. 2015;47:264-76.
- [CrossRef] [Google Scholar]
- Antibiotic resistance in Salmonella spp. Isolated from poultry: A global overview. Vet World. 2020;13:2070-84.
- [CrossRef] [PubMed] [Google Scholar]
- Salmonella infections. In: Diseases of Poultry. Hoboken: John Wiley and Sons. Inc; 2020. p. :717-53.
- [CrossRef] [Google Scholar]
- Isolation and molecular characterization of Salmonella enterica, Escherichia coli O157: H7 and Shigella spp. From meat and dairy products in Egypt. Int J Food Microbiol. 2014;168-169:57-62.
- [CrossRef] [PubMed] [Google Scholar]
- Isolation and molecular characterization of Salmonella enterica serovar Enteritidis from poultry house and clinical samples during 2010. Food Microbiol. 2014;38:67-74.
- [CrossRef] [PubMed] [Google Scholar]
- Epidemiology, clinical presentation, laboratory diagnosis, antimicrobial resistance, and antimicrobial management of invasive Salmonella infections. Clin Microbiol Rev. 2015;28:901-37.
- [CrossRef] [PubMed] [Google Scholar]
- Prevalence, serotyping and antimicrobials resistance mechanism of Salmonella enterica isolated from clinical and environmental samples in Saudi Arabia. Braz J Microbiol. 2017;48:499-508.
- [CrossRef] [PubMed] [Google Scholar]
- Phenotypic and genotypic analysis of clinical isolates Salmonella serovar Typhimurium in western Kenya. J Infect Dev Ctries. 2009;3:685-94.
- [CrossRef] [PubMed] [Google Scholar]
- Phenotypic and genotypic characterization of locally isolated Salmonella strains used in preparation of Salmonella antigens in Egypt. Vet World. 2016;9:1435-9.
- [CrossRef] [PubMed] [Google Scholar]
- Phenotypic and genotypic characterization of antimicrobial resistance in commonly isolated Salmonella serovars from chickens. Turk J Vet Anim Sci. 2023;47:19-25.
- [CrossRef] [Google Scholar]
- Phenotypic and genotypic characterization of Salmonella spp. Isolated from pigs and their farm environment in Korea. J Microbiol Biotechnol. 2011;21:50-4.
- [CrossRef] [PubMed] [Google Scholar]
- Phenotypic and genotypic characterization of Salmonella typhimurium isolates from humans and foods in Brazil. PLoS One. 2020;15:e0237886.
- [CrossRef] [PubMed] [Google Scholar]
- Phenotypic and genotypic characterization of temporally related nontyphoidal Salmonella strains isolated from humans and food animals in central Ethiopia. Zoonoses Public Health. 2018;65:766-76.
- [CrossRef] [PubMed] [Google Scholar]
- Phenotypic and genotypic characterization of Salmonella enterica serovars isolated from imported poultry. Adv Anim Vet Sci. 2021;9:823-34.
- [CrossRef] [Google Scholar]
- Isolation and identification of Salmonella spp. From broiler and their antibiogram study in Sylhet. Bangladesh. J Appl Biol Biotechnol. 2016;4:46-51.
- [Google Scholar]
- Isolation and identification of Salmonella Spp. From different food. Int J Biosci. 2016;8:16-24.
- [CrossRef] [Google Scholar]
- Antimicrobial susceptibility pattern of Salmonella spp. Isolated from enteric fever patients in Nepal. Infect Dis Rep. 2021;13:388-400.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular identification and antibiotic resistance profiling of Salmonella species isolated from chickens in eastern Turkey. BMC Vet Res. 2020;16:205.
- [CrossRef] [PubMed] [Google Scholar]

