Investigating the presence and virulence potential of Enterococcus faecalis, with a focus on the hyaluronidase factor, in environmental samples: Insights from a pilot study

Ethics approval

The collection of environmental samples for this study was carried out in strict adherence to ethical guidelines. The Institutional Ethics Committee (IEC) granted the necessary approval for the conduct of the study (CSP/23/JUN/130/540).

Sample collection

A total of 32 environmental samples were procured from various locations in and around Chennai. The collection process employed sterile 15 mL Falcon tubes to ensure the integrity and uncontaminated nature of the samples. 10 mL of water sample was collected using sterile falcon tubes. For solid samples, 5 g was collected from different environments. As this is a pilot study, no specific criteria were applied for sampling except that the samples should be of different types such as water and soil. The details of the sample collection are given in Table 1.

Sample processing

To prepare the samples, 4.0 mL of distilled water was added to 1.0 g of solid samples in Falcon tubes. Subsequently, 2.5 mL of the resulting diluted sample was mixed with an equal volume of Ethyl Violet Azide broth (EVA broth). For water samples, 2.5 mL directly combined with 2.5 mL of EVA broth. The tubes were then subjected to a 48-h incubation period.

Bacteriological isolation and biochemical identification

Bacterial isolation was conducted using EVA agar, a partially selective medium specifically inhibiting the growth of nonenterococcal Gram-positive and Gram-negative bacteria due to the inclusion of sodium azide. After 24–48 h of incubation at 37°C, gray colonies indicative of enterococcal species were observed. These gray colonies were subcultured onto Brain Heart Infusion agar. In addition, colonies were streaked onto Bile esculin agar plates to confirm the presence of Enterococcus species through esculin hydrolysis, resulting in brownish-black precipitate colonies. All dehydrated culture media were procured from (HiMedia^™ Laboratories Pvt Ltd).

DNA extraction

DNA extraction from all samples utilized the boiling lysis method as described by Dashti et al. and Yost and Nattress.^[5,6] Following centrifugation of 1.0 mL of the broth culture for 5 min at 10,000 rpm, the supernatant was discarded, and 200 mL of sterile distilled water was added. The mixture was then subjected to a dry bath at 95°C. Two microliters of the resulting supernatant served as the template in polymerase chain reaction (PCR), as per the method outlined by Mullis et al.^[7] Extracted DNA was stored at −20°C for subsequent analysis.

Molecular identification using 16S ribosomal RNA (rRNA)

Primer designing

Enterococcus isolates were further identified as E. faecalis using Sequence-Specific Oligonucleotide Primers (SSOPs) in PCR. Primers were designed with the assistance of the online primer designing tool, Primer3.^[8] The 16S rRNA gene sequence, retrieved from the Nucleotide database of National Center for Biotechnology Information (accession id: AB036835.1), was submitted to the Primer3 tool. Default parameters were slightly modified to ensure the product size of the amplicon fell between 500 and 1000 nucleotides. The pick primer option was employed, and the results are illustrated in Figure 1. The melting temperatures of the forward and reverse primers were 59.03°C and 59.01°C, respectively.

Close

Figure 1:

Primer designing using primer 3.

Export to PPT

Molecular detection

For the molecular identification of all isolates in the study, PCR amplification of the E. faecalis 16S rRNA gene was performed and the primers were as follows: Forward primer 5’CTGGGAGACTTGAGTGCAGA3’ and Reverse 5’ATTTGACGTCATCCCCACCT3’ (Sigma Aldrich, USA). The primer details are given in Table 2. A primer concentration of 0.4 mM was employed. PCR was executed using Taq DNA Polymerase 2x Master Mix RED (Ampliqon, Denmark) in a 20 µl reaction maintaining a pH of 8.5 with Tris-HCl pH 8.5, ammonium sulfate. It also has 3 mM magnesium chloride, 0.2% Tween^®20, 0.4 mM of each deoxynucleotide triphosphate, and 0.2 units/µL Taq DNA polymerase. Moreover, the TaqMix is added with an inert red dye for tracking in the agarose gel. The cycling parameters for amplification were as follows: Initial denaturation - 95°C; 5’, denaturation - 95°C; 45”, annealing - 60°C; 45”, extension - 72°C; 1’, repeated for 30 cycles. Subsequent to an 8-min final extension at 72°C, the reaction mixtures were cooled to 4°C. Gel electrophoresis of the PCR products was carried out on 1.2% agarose gel and visualized using an ultraviolet (UV) Transilluminator (White/UV transilluminator UVP). The 2 Kbp DNA ladder (Thermo Fisher Scientific, US) was used in all agarose gel electrophoresis experiments.

Detection of the virulence factor, hyl

PCR-cycling parameters

For the 16S rRNA PCR of the hyl gene, the cycling conditions are as follows: Initial denaturation - 95°C; 5’, denaturation - 95°C; 45’’, annealing - 60°C; 45”, extension - 72°C; 1’ with 30 cycles. Following an 8-min final extension at 72°C, the reaction mixtures were then cooled to 4°C.

Visualization and documentation

PCR products were run on a 1.2% agarose gel that has ethidium bromide at a working concentration of 0.2 mg/µL (16 µL/80 µL). Electrophoresis was conducted in a 1× TBE buffer for 30 min at 70V. Subsequently, bands were visualized under a UV transilluminator (UVP Upland, USA) and documented using a Gel Documentation System (Vilber Lourmat, USA). Molecular Marker 16S rRNA PCR was conducted for all isolates, with primers designed specifically for detection, yielding an amplicon size of 557bp. E. faecalis ATCC 29212 served as the positive control, and a 2 Kbp DNA ladder (Thermo Fisher Scientific, US) was used as a marker with 500 bp as the lowest band. DNA bands were observed in all wells except the negative control, indicating the absence of contamination. The results were documented using the Gel Documentation instrument and UV illuminator (White/UV Transilluminator UVP).

Isolation and biochemical identification

For the biochemical identification of Enterococcus species, EVA plates were employed to culture the isolates. Following an overnight incubation period, colony morphology on EVA plates were scrutinized. The isolates inoculated onto EVA plates and incubated at 37°C showed the formation of typical opaque, entire, and pinpoint colonies while reading. Subsequent subculturing of the 32 isolates on EVA agar plates revealed 30 isolates showing grayish pinpointed colonies characteristic of E. faecalis. Notably, isolates S16 and L4 were exceptions, yielding negative results in this biochemical identification process. The results are shown in Figures 2 and 3.

Close

Figure 2:

Ethyl Violet Azide plate with greyish white colonies.

Export to PPT

Close

Figure 3:

Bile Esculin plate with brownish-black precipitate colonies.

Export to PPT

Bile esculin test

Colonies sourced from the EVA plates were streaked onto bile esculin agar plates, and the outcomes revealed a color change from dark brown to black. This transformation indicated the hydrolysis of bile salts within the medium.

Molecular detection of E. faecalis

The isolates underwent PCR analysis using SSOPs for the 16S rRNA gene. The anticipated amplicon was consistently observed across all isolates. Documentation of results was carried out using the gel documentation system. Both the positive and negative controls demonstrated satisfactory outcomes, with ATCC 29212 serving as the positive control. A 2 Kbp DNA ladder was employed as a marker, with the lowest band at 500 bp. The expected amplicon size of 557 bp was evident on the 1.2% agarose gel for 11 isolates (41%), refer to Figure 4 for a visual representation of the results.

Close

Figure 4:

16S Ribosomal ribonucleic acid polymerase chain reaction.

Export to PPT

Detection of hyl gene in E. faecalis isolates

PCR targeting the hyl gene was conducted for all 11 isolates using SSOPs. Notably, the results indicated that none of the 11 isolates tested positive for the presence of the hyl gene. The results are shown in Figure 5.

Close

Figure 5:

Hyaluronidase gene polymerase chain reaction.

Export to PPT